Draft genome of the first case of the Monkeypox virus in Chile associated with the 2022 outbreak

MPXV Genome Reports
1

Draft genome of the first case of the Monkeypox virus in Chile associated with the 2022 outbreak.

Paulo C. Covarrubias¹, Andrés E. Castillo¹, Vivian Gomez¹, Constanza Campano¹, Mariela Guajardo¹, Marcelo Rojas¹, Bárbara Parra¹, Patricia Bustos², Alejandra Acevedo², Carolina Tambley², Rodrigo A. Fasce,², Jorge Fernández¹.

¹Sub Department of Molecular Genetics, Institute of Public Health of Chile, Santiago, Chile.

²Sub Department of Virology, Institute of Public Health of Chile, Santiago, Chile.

Monkeypox virus (MPXV) is a double-stranded DNA virus belonging to the genus Orthopoxviruses. It is a zoonotic virus endemic to West and Central Africa that produces symptoms similar to those seen in the past in smallpox patients, although clinically less severe¹. An outbreak of the Monkeypox virus was detected in several non-endemic countries, mainly in Europe in May 2022. This virus affects mainly men who have sexual intercourse with men who have reported recent sexual relations with new or multiple partners².

Since January 1st, 2022, monkeypox cases have been reported to WHO, and as of July 7th, a total of 7,892 laboratory-confirmed cases have been reported to WHO. The majority of the confirmed cases are from the Europe region (6,496). Confirmed cases have also been reported in the Region of the Americas (1,184), the African Region (173), the Eastern Mediterranean Region (15), and the Western Pacific Region (24)². On June 17th, 2022, Chile reported the first case of Monkeypox virus: an adult from the Metropolitan Region with a history of travel to Europe who presented symptoms of sudden exanthema (spots on the skin), vesiculated lesions, skin scabs, accompanied by decay and lymphadenopathy.
Here we report the first draft genome and phylogenetic analysis of a monkeypox case detected in Chile.

Description of the methods

All suspicious cases were processed according to the guidelines suggested by the World Health Organization (WHO)³. The DNA was extracted from tissue using NucliSENS EasyMag (Biomérieux). The sample was confirmed as positive by real-time reverse transcription-polymerase chain reaction (RT-PCR) with a ct value under 35 and Sanger sequencing of the F3L, F4L, E5R, and N3R genes. Those amplicons were obtained by PCR using specific primers, synthesized, and purified in our facilities (Table 1). SapphireAmp Fast PCR Master Mix (Cat. No. RR350B, Takara), was used for PCR reaction with the running method at 95°C for 2 minutes, followed by 45 cycles at 95°C for 15 seconds, 52°C for 15, and 72°C for 15 seconds.

Table 1: List of primers used for identification of MPXV by Sanger sequencing.

Primer name Gen Target Sequence
MPXV_E5R_F E5R MPXV ATGTTGATATTAATAATCGTATTGTGGT
MPXV_E5R_R E5R MPXV AAAGTCAATGCACTCTTAAAGATTCTCAA
F4L_F F4L Orthopoxvirus CGTTGGAAAACGTGAGTCCGG
F4L_R F4L Orthopoxvirus ATTGGCGTTTTTTGCAGCCAG
F3L-F290 F3L MPXV CTCATTGATTTTTCGCGGGATA
F3L-500-Rv F3L MPXV TTACAACGCAATCGATACATG
N3R-F319 N3R MPXV AACAACCGTCCTACAATTAAACAACA
N3R-500-Rv N3R MPXV TAATGCAGATATAATATCTTT

For the whole genome sequencing, the extracted DNA was quantified using fluorimetry with the Qubit dsDNA High Sensitivity Assay (Cat. Q32854, Life Technologies) on the Qubit 2.0 instrument. Shotgun metagenomics was performed in duplicate using 100 ng of the extracted DNA using Nextera DNA Flex Library Prep Kit (Cat. 20018705, Illumina) and paired-end sequencing (2x250 bp) on an Illumina Miseq with about ~25 million total reads with 88%> Q30.

Paired Illumina FASTQ files were pre-processed using an in-house pipeline to remove adapters and low-quality sequences. High-quality sequences were interleaved using the reformat tool from the BBMap2 V.38.68 software to generate a single interleaved Fastq file. Secondly, human-associated reads were depleted using the NCBI SRA Human Scrubber (v.1.1.2021-05-05)⁴. The remaining reads were used for the following steps. A reference-based analysis was conducted with Illumina reads that were mapped to the reference MPXV_USA_2022_MA001 (GenBank accession: ON563414.3)⁵ with the use of BWA⁶ software tool v.0.7.17-r1188. At this stage, duplicate metrics from PICARD v.2.23.1 (Picard Tools - By Broad Institute), and coverage metrics from SAMtools v.1.6⁷ were obtained from the remaining analyzed sequences. Subsequently, variant calling was carried out using iVar v.1.0⁸ using the default parameters against the reference (GenBank accession: ON563414.3). Consensus sequences in FASTA format were obtained using the pileup methodology from SAMtools plus the consensus option from iVar as described in previous works⁹.

The percentage of non-human mapped reads was 15.36%, with an average depth of 200X, covering 100% of the reference genome (197,205 bp). The consensus genome sequence has been submitted to GISAID with the entry EPI_ISL_14224334 and is also available under NCBI SRA Accession Number PRJNA865735.

For the phylogenetic reconstruction, we select a subset of 95 representative genomes from different origins and clades. Representative genomes used include 73 sequences from the recent 2022 outbreak; all sequences used were obtained from the nextstrain/monkeypox project. The phylogenetic tree was constructed using the nextstrain pipeline for monkeypox in the https://github.com/nextstrain/monkeypox/hmpxv1, which is focused on human-to-human transmission (“recent outbreak”). Employed tools were nextalign2¹⁰ for sequence alignment, the IQ-tree¹¹ with GTR model for phylogenetic reconstruction, and TreeTime¹² for the ancestral reconstruction and temporal inference. The generated Newick tree was visualized using the online tool Microreact¹³ along with the metadata associated with the samples obtained from nextstrain/monkeypox.

Maximum-Likelihood (GTR model) phylogenetic tree for 95 available Monkeypox genomes
Maximum-Likelihood (GTR model) phylogenetic tree for 95 available Monkeypox genomes1215×609 172 KB

Figure 1. Maximum-Likelihood (GTR model) phylogenetic tree for 95 available Monkeypox genomes, including a selection of 73 sequences from the 2022 outbreak. Highlighted genome corresponds to the first Chilean case genome sequence. The right side map shows the distribution of the analyzed genomes colored by clade.

The Sanger sequencing method of the F3L, N3R, F4L and E5R gene fragments allowed the identification of the monkeypox virus. Preliminary analysis (Figure 1) shows that the obtained genome belongs to the West African clade of MPXV and is most closely related to the genomes from the 2022 outbreak.

References

  1. Alakunle, E., Moens, U., Nchinda, G., & Okeke, M. I. (2020). Monkeypox Virus in Nigeria: Infection Biology, Epidemiology, and Evolution. Viruses, 12(11), 1257.
  2. PAHO, Epidemiological Update on Monkeypox - 9 July 2022. Epidemiological Update on Monkeypox - 9 July 2022 - PAHO/WHO | Pan American Health Organization
  3. Laboratory testing for the monkeypox virus: Interim guidance, 23 May 2022, Laboratory testing for the monkeypox virus: Interim guidance
  4. Katz, K. S., Shutov, O., Lapoint, R., Kimelman, M., Brister, J. R., & O’Sullivan, C. (2021). STAT: a fast, scalable, MinHash-based k-mer tool to assess Sequence Read Archive next-generation sequence submissions. Genome biology, 22(1), 1-15.
  5. Gigante, C. M., Smole, S., Wilkins, K., McCollum, A., Hutson, C., & Davidson, W. (2022). Draft monkeypox virus genome from confirmed monkeypox case in Massachusetts, United States. 2022.
  6. Li, H., & Durbin, R. (2010). Fast and accurate long-read alignment with Burrows–Wheeler transform. Bioinformatics, 26(5), 589-595.
  7. Danecek, P., Bonfield, J. K., Liddle, J., Marshall, J., Ohan, V., Pollard, M. O., … & Li, H. (2021). Twelve years of SAMtools and BCFtools. Gigascience, 10(2), giab008.
  8. Grubaugh, N. D., Gangavarapu, K., Quick, J., Matteson, N. L., De Jesus, J. G., Main, B. J., Tan, A. L., Paul, L. M., Brackney, D. E., Grewal, S., Gurfield, N., Van Rompay, K., Isern, S., Michael, S. F., Coffey, L. L., Loman, N. J., & Andersen, K. G. (2019). An amplicon-based sequencing framework for accurately measuring intrahost virus diversity using PrimalSeq and iVar. Genome biology, 20(1), 8.
  9. Isidro, J., Borges, V., Pinto, M., Sobral, D., Santos, J. D., Nunes, A., Mixão, V., Ferreira, R., Santos, D., Duarte, S., Vieira, L., Borrego, M. J., Núncio, S., de Carvalho, I. L., Pelerito, A., Cordeiro, R., & Gomes, J. P. (2022). Phylogenomic characterization and signs of microevolution in the 2022 multi-country outbreak of monkeypox virus. Nature medicine, 10.1038/s41591-022-01907-y. Advance online publication.
  10. Hadfield, J., Megill, C., Bell, S. M., Huddleston, J., Potter, B., Callender, C., … & Neher, R. A. (2018). Nextstrain: real-time tracking of pathogen evolution. Bioinformatics, 34(23), 4121-4123.
  11. Nguyen, L. T., Schmidt, H. A., Von Haeseler, A., & Minh, B. Q. (2015). IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular biology and evolution, 32(1), 268-274.
  12. Sagulenko, P., Puller, V., & Neher, R. A. (2018). TreeTime: Maximum-likelihood phylodynamic analysis. Virus evolution, 4(1), vex042.
  13. Argimón, S., Abudahab, K., Goater, R. J., Fedosejev, A., Bhai, J., Glasner, C., … & Aanensen, D. M. (2016). Microreact: visualizing and sharing data for genomic epidemiology and phylogeography. Microbial genomics, 2(11).