The fact that that area of the SARS-CoV-2 genome is a site of RNA polymerase stuttering is clear from the tandem repeat in the RNA sequence, that evidently occurred in the long ago ancestor of SARS-CoV-2 and Bat RaTG13 (tandem repeat mutated in latter) just upstream of the site of the insert, thusly,
SARS-CoV-2 tat cagact cagact tgctcctcggcgggcacgtagt
This is, after all, a looped out peptide sequence, and even when the furin site is common, as in other Coronaviruses, there is not strict alignment relative to neighboring, more constant, peptide regions. The irony of a functionally important loop that is also hypervariable.
Bill Gallaher