Preliminary in silico assessment of the specificity of published molecular assays and design of new assays using the available whole genome sequences of 2019-nCoV

hhttps://www.thelancet.com/action/showPdf?pii=S0140-6736%2820%2930183-5

Reported in Methods section, in Procedures subsection on page 2 of article:

“The primers and probe target to envelope gene of CoV were used and the sequences were as follows: forward primer 5′-TCAGAATGCCAATCTCCCCAAC-3′; reverse primer 5′-AAAGGTCCACCCGATACATTGA-3′; and the probe 5′CY5-CTAGTTACACTAGCCATCCTTACTGC-3′BHQ1.”

The forward and reverse primers reported here do not seem to correspond to nCoV sequences. However, I found them in another paper listed below and are from Saffold Cardiovirus.

Saffold Cardiovirus in Children with Acute Gastroenteritis, Beijing, ChinaLili Ren, Richard Gonzalez, Yan Xiao, Xiwei Xu, Lan Chen, Guy Vernet, Gláucia Paranhos-Baccalà, Qi Jin, and Jianwei Wang

“Because VP1 genes of 2 SAFV-positive samples could not be amplified in this way, a newly designed primer pair (cardioVP1Fn: TCAGAATGCCAATCTCCCCAAC and cardioVP1Rn: AAAGGTCCACCCGATACATTGA) was used in combination with cardioVP1-2F/3R to amplify the VP1 gene based on the sequences obtained from our positive samples.”

Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 15, No. 9, September 2009

1 Like