Preliminary in silico assessment of the specificity of published molecular assays and design of new assays using the available whole genome sequences of 2019-nCoV

SARS-CoV-2 coronavirus nCoV-2019 Diagnostics and Vaccines
9

PSET results updated with new 2019-nCoV genomes; 129 total genomes. Now just using the subset of genomes on GISAID marked as high quality. Sequence IDs tested in this analysis listed here: ncov_ids_tested.zip (437 Bytes)

Assays have more potential false negatives, although the majority of FNs (38 out of 42) are from samples collected from Pangolins. Only assays ncov_rdp_1 and cdc_n3 currently have no potential for FNs.

Table 1. Results from PSET analysis. The four Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Each assay was tested using 2019-nCoV (129 genomes) as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt, gss, and env_nt).

identifier provider PT TP TN PF FP FN
2019-nCoV-noblis_1 Noblis 91 32 372 NA NA 6
2019-nCoV-noblis_2 Noblis 123 NA 568 NA NA 6
2019-nCoV-noblis_3 Noblis 122 2 439 NA NA 5
2019-nCoV-noblis_4 Noblis 121 5 343 NA 3 3
ncov_e_gene Corman et al 127 1 42 353 15 1
ncov_n_gene Corman et al 122 2 55 NA 339 5
ncov_rdrp_1 Corman et al NA 129 75 433 87 NA
ncov_rdrp_2 Corman et al NA 124 526 1 66 5
cdc_n1 CDC 122 2 363 NA NA 5
cdc_n2 CDC 122 1 361 NA NA 6
cdc_n3 CDC 121 8 17 NA 346 NA
10

PSET results updated with new 2019-nCoV genomes; 152 total genomes. Now just using the subset of genomes on GISAID marked as high quality. Sequence IDs tested in this analysis listed here: ncov_ids_tested.zip (475 Bytes)

Table 1. Results from PSET analysis. The four Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Each assay was tested using 2019-nCoV (152 genomes) as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt, gss, and env_nt).

identifier provider PT TP TN PF FP FN
2019-nCoV-noblis_1 Noblis 106 39 373 NA NA 7
2019-nCoV-noblis_2 Noblis 145 NA 568 NA NA 7
2019-nCoV-noblis_3 Noblis 144 2 439 NA NA 6
2019-nCoV-noblis_4 Noblis 144 5 343 NA 3 3
ncov_e_gene Corman et al 149 2 42 353 15 1
ncov_n_gene Corman et al 144 3 55 NA 339 5
ncov_rdrp_1 Corman et al NA 152 75 433 87 NA
ncov_rdrp_2 Corman et al NA 147 526 1 66 5
cdc_n1 CDC 144 3 363 NA NA 5
cdc_n2 CDC 144 1 361 NA NA 7
cdc_n3 CDC 143 9 17 NA 346 NA
11

PSET results updated with new 2019-nCoV genomes; 190 total genomes. Now just using the subset of genomes on GISAID marked as high quality sampled from humans (pangolin samples removed). Sequence IDs tested in this analysis listed here: ncov_ids_tested.zip (534 Bytes)

Table 1. Results from PSET analysis. The four Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Each assay was tested using 2019-nCoV (190 genomes) as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt, gss, and env_nt).

identifier provider PT TP TN PF FP FN
2019-nCoV-noblis_1 Noblis 134 56 373 0 0 0
2019-nCoV-noblis_2 Noblis 188 2 568 0 0 0
2019-nCoV-noblis_3 Noblis 189 1 439 0 0 0
2019-nCoV-noblis_4 Noblis 184 0 343 0 3 6
ncov_e_gene Corman et al 187 2 42 353 15 1
ncov_n_gene Corman et al 189 1 55 0 339 0
ncov_rdrp_1 Corman et al 190 0 75 433 87 0
ncov_rdrp_2 Corman et al 190 0 526 1 66 0
cdc_n1 CDC 188 2 363 0 0 0
cdc_n2 CDC 189 1 361 0 0 0
cdc_n3 CDC 183 7 17 0 346 0
12

PSET results updated with new 2019-nCoV genomes; 432 total genomes. Just using the subset of genomes on GISAID marked as high quality sampled from humans. Sequence IDs tested in this analysis listed here: 432_ids.zip (833 Bytes)

Noblis assay 4 showing some potential FNs, but most of these appear to be the result of gaps or sequencing errors for some sequences at the very start of the genome. This assay falls within the first 500bp of the genome. All other assays still performing very well in silico against new sequences.

Table 1. Results from PSET analysis. The four Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Each assay was tested using 2019-nCoV (432 genomes) as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt, gss, and env_nt).

identifier provider PT TP TN PF FP FN
2019-nCoV-noblis_1 Noblis 325 105 373 0 0 2
2019-nCoV-noblis_2 Noblis 422 10 568 0 0 0
2019-nCoV-noblis_3 Noblis 431 1 439 0 0 0
2019-nCoV-noblis_4 Noblis 409 4 343 0 3 19
ncov_e_gene Corman et al 428 3 42 353 15 1
ncov_n_gene Corman et al 431 1 55 0 339 0
ncov_rdrp_1 Corman et al 0 432 75 433 87 0
ncov_rdrp_2 Corman et al 0 432 526 1 66 0
cdc_n1 CDC 429 3 363 0 0 0
cdc_n2 CDC 430 2 361 0 0 0
cdc_n3 CDC 412 20 17 0 346 0
13

PSET results updated with new 2019-nCoV genomes; 655 total genomes. Just using the subset of genomes on GISAID marked as high quality sampled from humans. Sequence IDs tested in this analysis listed here: 655_ids.zip (1.4 KB)

Previous Noblis assays showed some false negatives due to Ns, sequence gaps, and in one case the assay’s position at the very start of the genome. These have been replaced with five new assays generated at a later date using 96 complete genomes. The Noblis.57 assay and the German ncov_e_gene assay each have one FN that’s due to a stretch of Ns. All other assays still performing very well in silico against new sequences.

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Each assay was tested using 2019-nCoV (655 genomes) as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt, gss, and env_nt).

identifier provider PT TP TN PF FP FN
Noblis.12 Noblis 653 2 2 0 0 0
Noblis.40 Noblis 635 20 316 0 0 0
Noblis.42 Noblis 655 0 275 0 0 0
Noblis.44 Noblis 655 0 277 0 0 0
Noblis.57 Noblis 654 0 359 0 0 1
ncov_e_gene Corman et al 651 3 42 353 15 1
ncov_n_gene Corman et al 652 3 55 0 339 0
ncov_rdrp_1 Corman et al 0 655 75 433 87 0
ncov_rdrp_2 Corman et al 1 654 526 1 66 0
cdc_n1 CDC 647 8 363 0 0 0
cdc_n2 CDC 653 2 361 0 0 0
cdc_n3 CDC 628 27 17 0 346 0

Figure 1. Map of the SARS-CoV-2 genome (NCBI Accession: MN908947.3) with assay signature locations (created using DNA Features Viewer Python library). Noblis assays in red, Corman assays in blue, CDC assays in purple, and gene regions in green.

wuhan_new1
wuhan_new12000×420 38.2 KB

14

PSET results updated with new 2019-nCoV genomes; 1620 total genomes. Just using the subset of genomes on GISAID marked as high quality sampled from humans. Sequence IDs tested in this analysis listed here: 1620_ids.zip (12.2 KB)

The Noblis.57 assay and the German ncov_e_gene assay still each have one FN that’s due to a stretch of Ns. All other assays still performing very well in silico against new sequences.

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Each assay was tested using 2019-nCoV (1620 genomes) as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt, gss, and env_nt).

identifier provider PT TP TN PF FP FN
Noblis.12 Noblis 1616 4 2 0 0 0
Noblis.40 Noblis 1546 74 316 0 0 0
Noblis.42 Noblis 1620 0 275 0 0 0
Noblis.44 Noblis 1619 1 277 0 0 0
Noblis.57 Noblis 1605 14 359 0 0 1
ncov_e_gene Corman et al 1616 3 42 353 15 1
ncov_n_gene Corman et al 1608 12 55 0 339 0
ncov_rdrp_1 Corman et al 0 1620 75 433 87 0
ncov_rdrp_2 Corman et al 1 1619 526 1 66 0
cdc_n1 CDC 1591 29 363 0 0 0
cdc_n2 CDC 1616 4 361 0 0 0
cdc_n3 CDC 1560 60 17 0 346 0
15

Dear S. Sozhamannan,

please can you share the new primer and probe sequences of Noblis.12-57 as you did with 2019-nCoV-noblis_1-4? That would be great.

BTW: Do you know the primer sequences used by doi:10.1128/JCM.00310-20? They are not provided with their paper and the author did not respond within the last 12 days.

Thanks!

1 Like
16

Sure thing! Here they are below. The full amplicon sequences are provided with the primers in brackets and probes in parentheses. We do not know the primers sequences used in that paper, but if we happen to find them we will let you know.

Identifier Amplicon
Noblis.12 [ACGGCAGTGAGGACAATCAG]ACAACTACTATTCAAACAATTGTTGAGGTTCAACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAGTTTTAGTGGTTATTTAAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAAAAGGTAAAA(CCAACAGTGGTTGTTAATGCAGCCA)ATGTTTACCTTAA[ACATGGAGGAGGTGTTGCAG]
Noblis.40 [GCCGCTGTTGATGCACTATG]TGAGAAGGCATTAAAATATTTGCCTATAGATAAATGTAGTAGAATTATACCTGC(ACGTGCTCGTGTAGAGTGTTTTGAT)AAATTCAAAGTGAATTCAACATTAGAACAGTATGTCTTTTGTACTGTAA[ATGCATTGCCTGAGACGACA]
Noblis.42 [TGTACGTGCATGGATTGGCT](TCGATGTCGAGGGGTGTCATGCT)ACTAGAGAAGCTGTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTACCTACAGGTTATGTTGATACACCTAATAATACAGATTTTTCCAGAGT[TAGTGCTAAACCACCGCCTG]
Noblis.44 [CAGGCACCTACACACCTCAG]TGTTGACACTAAATTCAAAACTGAAGGTTTATGTGTTGACATACCTGGCATACCTAAGGACATGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAATGGTTACCCTAACATGTTTATCACCCGCGAAGAAGCTATAAGACATGTACGTGCATGGAT(TGGCTTCGATGTCGAGGGGTGT)CATGCTACTAGAGAAGCTGTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTACCTACAGGTTATGTTGATACACCTAATAATACAGATTTTTCCAGAGT[TAGTGCTAAACCACCGCCTG]
Noblis.57 [TGCAGATGCTGGCTTCATCA]AACAATATGGTGATTGCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTA(ACGGCCTTACTGTTTTGCCACCT)TTGCTCACAGATGAAATGATTGCTCAATACACTT[CTGCACTGTTAGCGGGTACA]
19

**Small error identified in the results Table 1 from previous post on 4/10. Fixed below. (4/15/2020)

PSET results updated with new 2019-nCoV genomes; 3996 total genomes. Just using the subset of genomes on GISAID marked as high quality sampled from humans. Sequence IDs tested in this analysis listed here: 3996_ids.zip (29.1 KB)

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Each assay was tested using 2019-nCoV (3996 genomes) as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt, gss, and env_nt).

identifier provider PT TP TN PF FP FN
Noblis.12 Noblis 3984 12 2 0 0 0
Noblis.40 Noblis 3855 140 316 0 0 1
Noblis.42 Noblis 3990 6 275 0 0 0
Noblis.44 Noblis 3988 8 277 0 0 0
Noblis.57 Noblis 3967 25 359 0 0 4
ncov_e_gene Corman et al 3983 7 42 353 15 6
ncov_n_gene Corman et al 3965 31 55 0 339 0
ncov_rdrp_1 Corman et al 0 3995 75 433 87 1
ncov_rdrp_2 Corman et al 1 3995 526 1 66 0
cdc_n1 CDC 3919 77 363 0 0 0
cdc_n2 CDC 3982 14 361 0 0 0
cdc_n3 CDC 3883 113 17 0 346 0

Table 2. False negative hits along with affected assay and sequence identifiers.

num identifier accession outcome
1 ncov_e_gene France_ARA10968_2020_EPI_ISL_418431_2020-03-18 FN
2 ncov_e_gene USA_NY-NYUMC33_2020_EPI_ISL_418979_2020-03-17 FN
3 ncov_e_gene Italy_TE4959_2020_EPI_ISL_418259_2020-03-14 FN
4 ncov_e_gene France_ARA12626_2020_EPI_ISL_420612_2020-03-23 FN
5 ncov_e_gene France_ARA13074_2020_EPI_ISL_420622_2020-03-24 FN
6 ncov_e_gene France_Lyon_06042_2020_EPI_ISL_417333_2020-03-04 FN
7 ncov_rdrp_1 Australia_QLDID922_2020_EPI_ISL_418799_2020-02-28 FN
8 Noblis.40 USA_WA-S7_2020_EPI_ISL_416462_2020-02-24 FN
9 Noblis.57 Beijing_IVDC-BJ-005_2020_EPI_ISL_408485_2020-01-18 FN
10 Noblis.57 Canada_ON_PHL2223_2020_EPI_ISL_418381_2020 FN
11 Noblis.57 Canada_ON_PHL2273_2020_EPI_ISL_418383_2020 FN
12 Noblis.57 Canada_ON_PHL6884_2020_EPI_ISL_418343_2020-03-10 FN
20

Big Update-- Added 14 new assays to monitor. Updated NCBI databases (nt, env_nt) – 4/16/2020. Updated to 6,835 COVID-19 WGS from GISAID. Sequence IDs tested in this analysis listed here: 6835_ids.zip (44.5 KB)

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Along with new assays from China, Hong Kong, Thailand, Japan, and France. Each assay was tested using 2019-nCoV (6,835 genomes) as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt, gss, and env_nt).

identifier type PT TP FN Percent True PF FP TN
Noblis.12 Probe 6793 41 1 99.99% 0 0 4
Noblis.40 Probe 6524 310 1 99.99% 0 1 318
Noblis.42 Probe 6825 8 2 99.97% 0 1 0
Noblis.44 Probe 6823 11 1 99.99% 0 1 31
Noblis.57 Probe 6779 50 6 99.91% 0 1 7
ncov_e_gene Probe 6813 13 9 99.87% 361 15 3
ncov_n_gene Probe 6784 51 0 100.00% 0 340 27
ncov_rdrp_1 Probe 0 6834 1 99.99% 430 59 239
ncov_rdrp_2 Probe 1 6834 0 100.00% 2 37 677
cdc_n1 Probe 6689 146 0 100.00% 0 2 0
cdc_n2 Probe 6787 26 22 99.68% 0 1 330
cdc_n3 Probe 6683 145 7 99.90% 1 3 1
China_N Probe 5606 47 1182 82.71% 0 2 2
China_ORF1ab Probe 6753 63 19 99.72% 1 0 348
France_nCoV_IP2 Probe 6820 14 1 99.99% 1 0 1
France_nCoV_IP4 Probe 6816 19 0 100.00% 0 0 3
HKU-N Probe 6762 48 25 99.63% 320 9 4
HKU-ORF1b-nsp14 Probe 6807 27 1 99.99% 1 0 0
Japan_NIID_2019-nCOV_N Probe 0 6812 23 99.66% 0 0 360
Japan_NIID_WH-1_F24381 Outer 6777 58 0 100.00% 0 1 455
Japan_NIID_WH-1_F501 Outer 6723 100 12 99.82% 0 1 3
Japan_NIID_WH-1_F509 Outer 6769 52 14 99.80% 1 0 3
Japan_NIID_WH-1_Seq_F24383 Outer 6778 57 0 100.00% 0 0 456
Japan_NIID_WH-1_Seq_F519 Outer 6795 22 18 99.74% 0 1 3
Japan_WuhanCoV-spk1 Outer 6786 49 0 100.00% 1 1 454
Thailand_WH-NIC_N Probe 6760 75 0 100.00% 0 2 0
21

Updated to 7,903 COVID-19 WGS from GISAID. Just using the subset of genomes on GISAID marked as high quality sampled from humans.

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Along with new assays from China, Hong Kong, Thailand, Japan, and France. Each assay was tested using 2019-nCoV (7,903 genomes) as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt, gss, and env_nt).

identifier type PT TP FN Percent True PF FP TN
Noblis.12 Probe 7859 43 1 99.99% 0 0 680
Noblis.40 Probe 7569 333 1 99.99% 0 1 1420
Noblis.42 Probe 7892 9 2 99.97% 0 2 1136
Noblis.44 Probe 7890 12 1 99.99% 0 1 1786
Noblis.57 Probe 7837 59 7 99.91% 0 1 853
ncov_e_gene Probe 7878 16 9 99.89% 361 15 53
ncov_n_gene Probe 7841 60 2 99.97% 0 340 72
ncov_rdrp_1 Probe 0 7902 1 99.99% 433 105 5967
ncov_rdrp_2 Probe 1 7902 0 100.00% 2 73 5916
cdc_n1 Probe 7681 221 1 99.99% 0 2 381
cdc_n2 Probe 7848 32 23 99.71% 0 1 372
cdc_n3 Probe 7725 176 2 99.97% 1 353 36
China_N Probe 6514 58 1331 83.16% 0 2 691
China_ORF1ab Probe 7819 65 19 99.76% 1 0 367
France_nCoV_IP2 Probe 7866 36 1 99.99% 1 0 367
France_nCoV_IP4 Probe 7877 25 1 99.99% 0 0 1190
HKU-N Probe 7812 65 26 99.67% 327 33 34
HKU-ORF1b-nsp14 Probe 7872 30 1 99.99% 324 29 452
Japan_NIID_2019-nCOV_N Probe 0 7879 24 99.70% 0 0 384
Japan_NIID_WH-1_F24381 Outer 7836 67 0 100.00% 0 1 601
Japan_NIID_WH-1_F501 Outer 7762 128 13 99.84% 0 1 370
Japan_NIID_WH-1_F509 Outer 7826 62 15 99.81% 1 0 369
Japan_NIID_WH-1_Seq_F24383 Outer 7838 65 0 100.00% 0 0 606
Japan_NIID_WH-1_Seq_F519 Outer 7852 29 22 99.72% 0 1 369
Japan_WuhanCoV-spk1 Outer 7845 58 0 100.00% 1 1 594
Thailand_WH-NIC_N Probe 7822 80 1 99.99% 0 2 375
22

Updated to 15,411 COVID-19 WGS from GISAID. Using all genomes sampled from humans regardless of quality.

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Along with assays from China, Hong Kong, Thailand, Japan, and France. Each assay was tested using 2019-nCoV (15,411 genomes) as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt, gss, and env_nt).

identifier type PT TP FN Percent True PF FP TN
Noblis.12 Probe 15251 71 89 99.42% 0 0 680
Noblis.40 Probe 14742 606 63 99.59% 0 1 1420
Noblis.42 Probe 15327 23 61 99.60% 0 2 1136
Noblis.44 Probe 15130 36 245 98.41% 0 1 1786
Noblis.57 Probe 15165 117 129 99.16% 0 1 853
ncov_e_gene Probe 15278 48 85 99.45% 361 15 53
ncov_n_gene Probe 15222 116 73 99.53% 0 340 72
ncov_rdrp_1 Probe 0 15366 45 99.71% 433 105 5967
ncov_rdrp_2 Probe 1 15369 41 99.73% 2 73 5916
cdc_n1 Probe 15034 339 38 99.75% 0 2 381
cdc_n2 Probe 14958 120 333 97.84% 0 1 372
cdc_n3 Probe 15059 312 40 99.74% 1 353 36
China_N Probe 12170 153 3088 79.96% 0 2 691
China_ORF1ab Probe 14330 132 949 93.84% 1 0 367
France_nCoV_IP2 Probe 15295 60 56 99.64% 1 0 367
France_nCoV_IP4 Probe 15326 53 32 99.79% 0 0 1190
HKU-N Probe 14947 129 335 97.83% 327 33 34
HKU-ORF1b-nsp14 Probe 15278 70 63 99.59% 324 29 452
Japan_NIID_2019-nCOV_N Probe 0 15079 332 97.85% 0 0 384
Japan_NIID_WH-1_F24381 Outer 15184 152 75 99.51% 0 1 601
Japan_NIID_WH-1_F501 Outer 15109 195 107 99.31% 0 1 370
Japan_NIID_WH-1_F509 Outer 15156 140 115 99.25% 1 0 369
Japan_NIID_WH-1_Seq_F24383 Outer 15180 151 80 99.48% 0 0 606
Japan_NIID_WH-1_Seq_F519 Outer 15004 232 175 98.86% 0 1 369
Japan_WuhanCoV-spk1 Outer 15210 122 79 99.49% 1 1 594
Thailand_WH-NIC_N Probe 15226 142 43 99.72% 0 2 375
23

Updated to 17,446 COVID-19 WGS from GISAID.

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Along with assays from China, Hong Kong, Thailand, Japan, and France. Each assay was tested using SARS-CoV-2 as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt, gss, and env_nt).

identifier type targets PT TP FN Percent True PF FP TN
Noblis.12 Probe 2697049 17251 81 114 99.35% 0 0 680
Noblis.40 Probe 2697049 16740 627 79 99.55% 0 1 1420
Noblis.42 Probe 2697049 17338 33 75 99.57% 0 2 1136
Noblis.44 Probe 2697049 17127 48 271 98.45% 0 1 1786
Noblis.57 Probe 2697049 17153 137 156 99.11% 0 1 853
ncov_e_gene Probe 2697049 17297 50 99 99.43% 361 15 53
ncov_n_gene Probe 2697049 17199 143 104 99.40% 0 340 72
ncov_rdrp_1 Probe 2697049 0 17392 54 99.69% 433 105 5967
ncov_rdrp_2 Probe 2697049 2 17389 55 99.68% 2 73 5916
cdc_n1 Probe 2697049 16952 443 51 99.71% 0 2 381
cdc_n2 Probe 2697049 16939 137 370 97.88% 0 1 372
cdc_n3 Probe 2697049 17038 361 47 99.73% 1 353 36
China_N Probe 2697049 13895 241 3310 81.03% 0 2 691
China_ORF1ab Probe 2697049 16202 147 1097 93.71% 1 0 367
France_nCoV_IP2 Probe 2697049 17301 69 76 99.56% 1 0 367
France_nCoV_IP4 Probe 2697049 17308 75 63 99.64% 0 0 1190
HKU-N Probe 2697049 16938 145 363 97.92% 327 33 34
HKU-ORF1b-nsp14 Probe 2697049 17287 83 76 99.56% 324 29 452
Japan_NIID_2019-nCOV_N Probe 2697049 0 17076 370 97.88% 0 0 384
Japan_NIID_WH-1_F24381 Outer 2697049 17178 165 103 99.41% 0 1 601
Japan_NIID_WH-1_F501 Outer 2697049 16964 318 164 99.06% 0 1 370
Japan_NIID_WH-1_F509 Outer 2697049 17110 163 173 99.01% 1 0 369
Japan_NIID_WH-1_Seq_F24383 Outer 2697049 17172 165 109 99.38% 0 0 606
Japan_NIID_WH-1_Seq_F519 Outer 2697049 16948 253 245 98.60% 0 1 369
Japan_WuhanCoV-spk1 Outer 2697049 17208 133 105 99.40% 1 1 594
Thailand_WH-NIC_N Probe 2697049 17216 173 57 99.67% 0 2 375
25

*Updated to 25,181 COVID-19 WGS from GISAID. (*small error in previous post, re-uploaded with correction)

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Along with assays from China, Hong Kong, Thailand, Japan, and France. Each assay was tested using SARS-CoV-2 as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt, gss, and env_nt).

identifier type PT TP FN Percent True PF FP TN
Noblis.12 Probe 24952 107 122 99.52% 0 0 680
Noblis.40 Probe 24227 871 83 99.67% 0 1 1420
Noblis.42 Probe 25011 43 127 99.50% 0 2 1136
Noblis.44 Probe 24681 75 425 98.31% 0 1 1786
Noblis.57 Probe 24777 210 194 99.23% 0 1 853
ncov_e_gene Probe 25005 68 108 99.57% 361 15 53
ncov_n_gene Probe 24847 214 120 99.52% 0 340 72
ncov_rdrp_1 Probe 0 25122 59 99.77% 433 105 5967
ncov_rdrp_2 Probe 2 25119 60 99.76% 2 73 5916
cdc_n1 Probe 24582 533 66 99.74% 0 2 381
cdc_n2 Probe 24617 181 383 98.48% 0 1 372
cdc_n3 Probe 24675 399 107 99.58% 1 353 36
China_N Probe 18633 320 6228 75.27% 0 2 691
China_ORF1ab Probe 23801 150 1230 95.12% 1 0 367
France_nCoV_IP2 Probe 24984 106 91 99.64% 1 0 367
France_nCoV_IP4 Probe 24927 180 74 99.71% 0 0 1190
HKU-N Probe 24627 179 375 98.51% 327 33 34
HKU-ORF1b-nsp14 Probe 24942 145 94 99.63% 324 29 452
Japan_NIID_2019-nCOV_N Probe 0 24797 384 98.48% 0 0 384
Japan_NIID_WH-1_F24381 Outer 24762 291 128 99.49% 0 1 601
Japan_NIID_WH-1_F501 Outer 24614 388 179 99.29% 0 1 370
Japan_NIID_WH-1_F509 Outer 24767 227 187 99.26% 1 0 369
Japan_NIID_WH-1_Seq_F24383 Outer 24757 291 133 99.47% 0 0 606
Japan_NIID_WH-1_Seq_F519 Outer 24591 298 292 98.84% 0 1 369
Japan_WuhanCoV-spk1 Outer 24792 259 130 99.48% 1 1 594
Thailand_WH-NIC_N Probe 24878 232 71 99.72% 0 2 375
26

Updated to 30,561 COVID-19 WGS from GISAID.

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Along with assays from China, Hong Kong, Thailand, Japan, and France. Each assay was tested using SARS-CoV-2 as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt, gss, and env_nt).

identifier type PT TP FN Percent True PF FP TN
Noblis.12 Probe 30281 139 141 99.54% 0 0 680
Noblis.40 Probe 29454 1013 94 99.69% 0 1 1420
Noblis.42 Probe 30352 60 149 99.51% 0 2 1136
Noblis.44 Probe 30013 95 453 98.52% 0 1 1786
Noblis.57 Probe 30033 267 261 99.15% 0 1 853
ncov_e_gene Probe 30355 81 125 99.59% 361 15 53
ncov_n_gene Probe 30153 266 142 99.54% 0 340 72
ncov_rdrp_1 Probe 0 30483 78 99.74% 433 105 5967
ncov_rdrp_2 Probe 2 30483 76 99.75% 2 73 5916
cdc_n1 Probe 29815 664 82 99.73% 0 2 381
cdc_n2 Probe 29912 249 400 98.69% 0 1 372
cdc_n3 Probe 29996 497 68 99.78% 1 353 36
China_N Probe 22004 375 8182 73.23% 0 2 691
China_ORF1ab Probe 28846 183 1532 94.99% 1 0 367
France_nCoV_IP2 Probe 30343 122 96 99.69% 1 0 367
France_nCoV_IP4 Probe 30271 208 82 99.73% 0 0 1190
HKU-N Probe 29953 218 390 98.72% 327 33 34
HKU-ORF1b-nsp14 Probe 30247 209 105 99.66% 324 29 452
Japan_NIID_2019-nCOV_N Probe 0 30160 401 98.69% 0 0 384
Japan_NIID_WH-1_F24381 Outer 30007 394 160 99.48% 0 1 601
Japan_NIID_WH-1_F501 Outer 29912 437 212 99.31% 0 1 370
Japan_NIID_WH-1_F509 Outer 30075 265 221 99.28% 1 0 369
Japan_NIID_WH-1_Seq_F24383 Outer 30002 391 168 99.45% 0 0 606
Japan_NIID_WH-1_Seq_F519 Outer 29898 320 343 98.88% 0 1 369
Japan_WuhanCoV-spk1 Outer 30039 352 170 99.44% 1 1 594
Thailand_WH-NIC_N Probe 30203 273 85 99.72% 0 2 375
27

Updated to 34,646 COVID-19 WGS from GISAID.

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Along with assays from China, Hong Kong, Thailand, Japan, and France. Each assay was tested using SARS-CoV-2 as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt and env_nt).

identifier type PT TP FN Percent True PF FP TN
Noblis.12 Probe 34345 148 153 99.56% 0 0 680
Noblis.40 Probe 33477 1073 96 99.72% 0 1 1420
Noblis.42 Probe 34424 66 156 99.55% 0 2 1136
Noblis.44 Probe 34059 119 468 98.65% 0 1 1786
Noblis.57 Probe 34064 301 281 99.19% 0 1 853
ncov_e_gene Probe 34379 93 174 99.50% 361 15 53
ncov_n_gene Probe 34175 297 174 99.50% 0 340 72
ncov_rdrp_1 Probe 0 34563 83 99.76% 433 105 5967
ncov_rdrp_2 Probe 2 34563 81 99.77% 2 73 5916
cdc_n1 Probe 33786 770 90 99.74% 0 2 381
cdc_n2 Probe 33957 272 417 98.80% 0 1 372
cdc_n3 Probe 33981 536 129 99.63% 1 353 36
China_N Probe 24954 415 9277 73.22% 0 2 691
China_ORF1ab Probe 32864 172 1610 95.35% 1 0 367
France_nCoV_IP2 Probe 34392 140 114 99.67% 1 0 367
France_nCoV_IP4 Probe 34327 233 86 99.75% 0 0 1190
HKU-N Probe 33992 247 407 98.83% 327 33 34
HKU-ORF1b-nsp14 Probe 34317 213 116 99.67% 324 29 452
Japan_NIID_2019-nCOV_N Probe 0 34217 429 98.76% 0 0 384
Japan_NIID_WH-1_F24381 Outer 34037 429 180 99.48% 0 1 601
Japan_NIID_WH-1_F501 Outer 33845 560 241 99.30% 0 1 370
Japan_NIID_WH-1_F509 Outer 34042 301 303 99.13% 1 0 369
Japan_NIID_WH-1_Seq_F24383 Outer 34028 429 189 99.45% 0 0 606
Japan_NIID_WH-1_Seq_F519 Outer 33835 371 440 98.73% 0 1 369
Japan_WuhanCoV-spk1 Outer 34079 380 187 99.46% 1 1 594
Thailand_WH-NIC_N Probe 34261 289 96 99.72% 0 2 375
28

Updated to 39,051 COVID-19 WGS from GISAID.

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Along with assays from China, Hong Kong, Thailand, Japan, and France. Each assay was tested using SARS-CoV-2 as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt and env_nt).

identifier type PT TP FN Percent True PF FP TN
Noblis.12 Probe 38711 176 164 99.58% 0 0 680
Noblis.40 Probe 37741 1210 100 99.74% 0 1 1420
Noblis.42 Probe 38796 77 178 99.54% 0 2 1136
Noblis.44 Probe 38391 158 502 98.71% 0 1 1786
Noblis.57 Probe 38355 381 315 99.19% 0 1 853
ncov_e_gene Probe 38740 118 193 99.51% 361 15 53
ncov_n_gene Probe 38441 400 210 99.46% 0 340 72
ncov_rdrp_1 Probe 0 38960 91 99.77% 433 105 5967
ncov_rdrp_2 Probe 2 38960 89 99.77% 2 73 5916
cdc_n1 Probe 37989 958 104 99.73% 0 2 381
cdc_n2 Probe 38168 308 575 98.53% 0 1 372
cdc_n3 Probe 38297 611 143 99.63% 1 353 36
China_N Probe 27528 485 11038 71.73% 0 2 691
China_ORF1ab Probe 37074 248 1729 95.57% 1 0 367
France_nCoV_IP2 Probe 38748 177 126 99.68% 1 0 367
France_nCoV_IP4 Probe 38713 249 89 99.77% 0 0 1190
HKU-N Probe 38159 325 567 98.55% 327 33 34
HKU-ORF1b-nsp14 Probe 38696 232 123 99.69% 324 29 452
Japan_NIID_2019-nCOV_N Probe 0 38461 590 98.49% 0 0 384
Japan_NIID_WH-1_F24381 Outer 38357 475 219 99.44% 0 1 601
Japan_NIID_WH-1_F501 Outer 38119 662 270 99.31% 0 1 370
Japan_NIID_WH-1_F509 Outer 38376 330 345 99.12% 1 0 369
Japan_NIID_WH-1_Seq_F24383 Outer 38347 475 229 99.41% 0 0 606
Japan_NIID_WH-1_Seq_F519 Outer 38137 401 513 98.69% 0 1 369
Japan_WuhanCoV-spk1 Outer 38403 422 226 99.42% 1 1 594
Thailand_WH-NIC_N Probe 38585 356 110 99.72% 0 2 375
29

Updated to 45,665 COVID-19 WGS from GISAID.

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Along with assays from China, Hong Kong, Thailand, Japan, France, South Korea, and Singapore. 12 New assays added. Each assay was tested using SARS-CoV-2 as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt and env_nt).

identifier type PT TP FN Percent True PF FP TN
Noblis.12 Probe 45257 202 206 99.55% 0 0 680
Noblis.40 Probe 44122 1407 136 99.70% 0 1 1420
Noblis.42 Probe 45350 94 221 99.52% 0 2 1136
Noblis.44 Probe 44905 199 561 98.77% 0 1 1786
Noblis.57 Probe 44845 431 389 99.15% 0 1 853
ncov_e_gene Probe 45272 145 248 99.46% 361 15 53
ncov_n_gene Probe 44916 486 263 99.42% 0 340 72
ncov_rdrp_1 Probe 0 45528 137 99.70% 433 105 5967
ncov_rdrp_2 Probe 2 45531 132 99.71% 2 73 5916
cdc_n1 Probe 44356 1190 119 99.74% 0 2 381
cdc_n2 Probe 44682 352 631 98.62% 0 1 372
cdc_n3 Probe 44786 715 164 99.64% 1 353 36
China_N Probe 32237 557 12871 71.81% 0 2 691
China_ORF1ab Probe 43473 372 1820 96.01% 1 0 367
France_nCoV_IP2 Probe 45322 196 147 99.68% 1 0 367
France_nCoV_IP4 Probe 45289 275 101 99.78% 0 0 1190
HKU-N Probe 44664 374 627 98.63% 327 33 34
HKU-ORF1b-nsp14 Probe 45224 288 153 99.66% 324 29 452
Japan_NIID_2019-nCOV_N Probe 0 45011 654 98.57% 0 0 384
Japan_NIID_WH-1_F24381 Outer 44867 540 258 99.44% 0 1 601
Japan_NIID_WH-1_F501 Outer 44660 699 306 99.33% 0 1 370
Japan_NIID_WH-1_F509 Outer 44875 401 389 99.15% 1 0 369
Japan_NIID_WH-1_Seq_F24383 Outer 44855 542 268 99.41% 0 0 606
Japan_NIID_WH-1_Seq_F519 Outer 44561 492 612 98.66% 0 1 369
Japan_WuhanCoV-spk1 Outer 44931 466 268 99.41% 1 1 594
Thailand_WH-NIC_N Probe 45043 494 128 99.72% 0 2 375
Chan-N Probe 44758 282 625 98.63% 4 3 353
Chan-ORF1ab Probe 0 45266 399 99.13% 0 5 2
Chan-S Probe 44678 158 829 98.18% 5 0 2
Niu-E Probe 45162 223 280 99.39% 26 359 0
Won-E Outer 2 45443 220 99.52% 0 384 1
Won-N Outer 44620 827 218 99.52% 8 7 358
Won-ORF1ab Outer 45260 242 163 99.64% 5 2 313
Won-S Outer 43872 154 1639 96.41% 5 1 0
Yip-ORF1ab Outer 45075 141 449 99.02% 5 1 1
Young-N Probe 0 45433 232 99.49% 0 5 1
Young-ORF1ab Probe 45408 150 107 99.77% 5 1 0
Young-S Probe 44929 374 362 99.21% 4 1 0
30

Updated to 49,073 COVID-19 WGS from GISAID.

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Along with assays from China, Hong Kong, Thailand, Japan, France, South Korea, and Singapore. Each assay was tested using SARS-CoV-2 as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt and env_nt).

identifier type PT TP FN Percent True PF FP TN
Noblis.12 Probe 48626 231 216 99.56% 0 0 680
Noblis.40 Probe 47497 1438 138 99.72% 0 1 1420
Noblis.42 Probe 48706 110 257 99.48% 0 2 1136
Noblis.44 Probe 48260 245 568 98.84% 0 1 1786
Noblis.57 Probe 48176 494 403 99.18% 0 1 853
ncov_e_gene Probe 48666 155 252 99.49% 361 15 53
ncov_n_gene Probe 48275 528 270 99.45% 0 340 72
ncov_rdrp_1 Probe 0 48932 141 99.71% 433 105 5967
ncov_rdrp_2 Probe 2 48937 134 99.73% 2 73 5916
cdc_n1 Probe 47644 1306 123 99.75% 0 2 381
cdc_n2 Probe 48037 378 658 98.66% 0 1 372
cdc_n3 Probe 48149 750 174 99.65% 1 353 36
China_N Probe 34411 599 14063 71.34% 0 2 691
China_ORF1ab Probe 46769 465 1839 96.25% 1 0 367
France_nCoV_IP2 Probe 48702 222 149 99.70% 1 0 367
France_nCoV_IP4 Probe 48664 308 101 99.79% 0 0 1190
HKU-N Probe 47944 475 654 98.67% 327 33 34
HKU-ORF1b-nsp14 Probe 48608 304 161 99.67% 324 29 452
Japan_NIID_2019-nCOV_N Probe 0 48394 679 98.62% 0 0 384
Japan_NIID_WH-1_F24381 Outer 48220 591 262 99.47% 0 1 601
Japan_NIID_WH-1_F501 Outer 48001 756 316 99.36% 0 1 370
Japan_NIID_WH-1_F509 Outer 48212 448 413 99.16% 1 0 369
Japan_NIID_WH-1_Seq_F24383 Outer 48209 592 272 99.45% 0 0 606
Japan_NIID_WH-1_Seq_F519 Outer 47901 516 656 98.66% 0 1 369
Japan_WuhanCoV-spk1 Outer 48293 493 287 99.42% 1 1 594
Thailand_WH-NIC_N Probe 48428 513 132 99.73% 0 2 375
Chan-N Probe 48116 302 655 98.67% 4 3 353
Chan-ORF1ab Probe 0 48594 479 99.02% 0 5 2
Chan-S Probe 48050 179 844 98.28% 5 0 2
Niu-E Probe 48553 234 286 99.42% 26 359 0
Won-E Outer 2 48848 223 99.55% 0 384 1
Won-N Outer 47977 868 228 99.54% 8 7 358
Won-ORF1ab Outer 48630 277 166 99.66% 5 2 313
Won-S Outer 47016 353 1704 96.53% 5 1 0
Yip-ORF1ab Outer 48404 204 465 99.05% 5 1 1
Young-N Probe 0 48825 248 99.49% 0 5 1
Young-ORF1ab Probe 48811 155 107 99.78% 5 1 0
Young-S Probe 48298 400 375 99.24% 4 1 0
31

Updated to 54,429 COVID-19 WGS from GISAID.

Table 1. Results from PSET analysis. The five Noblis assays were compared alongside the four assays from Corman and three assays from the CDC. Along with assays from China, Hong Kong, Thailand, Japan, France, South Korea, and Singapore. Each assay was tested using SARS-CoV-2 as the intended target. All off-target hits (TN, PF, FP) are to entries in NCBI BLAST databases (nt and env_nt).

identifier type PT TP FN Percent True PF FP TN
Noblis.12 Probe 53921 230 278 99.49% 0 0 680
Noblis.40 Probe 52753 1525 151 99.72% 0 1 1420
Noblis.42 Probe 54023 118 288 99.47% 0 2 1136
Noblis.44 Probe 53559 260 610 98.88% 0 1 1786
Noblis.57 Probe 53411 528 490 99.10% 0 1 853
ncov_e_gene Probe 53985 168 276 99.49% 361 15 53
ncov_n_gene Probe 53515 597 317 99.42% 0 340 72
ncov_rdrp_1 Probe 0 54274 155 99.72% 433 105 5967
ncov_rdrp_2 Probe 2 54283 144 99.74% 2 73 5916
cdc_n1 Probe 52801 1481 147 99.73% 0 2 381
cdc_n2 Probe 53269 434 726 98.67% 0 1 372
cdc_n3 Probe 53422 807 200 99.63% 1 353 36
China_N Probe 37416 666 16347 69.97% 0 2 691
China_ORF1ab Probe 51819 432 2178 96.00% 1 0 367
France_nCoV_IP2 Probe 54026 226 177 99.67% 1 0 367
France_nCoV_IP4 Probe 53952 366 111 99.80% 0 0 1190
HKU-N Probe 53129 580 720 98.68% 327 33 34
HKU-ORF1b-nsp14 Probe 53922 338 169 99.69% 324 29 452
Japan_NIID_2019-nCOV_N Probe 0 53681 748 98.63% 0 0 384
Japan_NIID_WH-1_F24381 Outer 53440 689 300 99.45% 0 1 601
Japan_NIID_WH-1_F501 Outer 53229 822 378 99.31% 0 1 370
Japan_NIID_WH-1_F509 Outer 53368 597 464 99.15% 1 0 369
Japan_NIID_WH-1_Seq_F24383 Outer 53418 704 307 99.44% 0 0 606
Japan_NIID_WH-1_Seq_F519 Outer 53109 576 744 98.63% 0 1 369
Japan_WuhanCoV-spk1 Outer 53520 602 307 99.44% 1 1 594
Thailand_WH-NIC_N Probe 53610 661 158 99.71% 0 2 375
Chan-N Probe 53373 342 714 98.69% 4 3 353
Chan-ORF1ab Probe 0 53780 649 98.81% 0 5 2
Chan-S Probe 53251 203 975 98.21% 5 0 2
Niu-E Probe 53864 257 308 99.43% 26 359 0
Won-E Outer 2 54183 244 99.55% 0 384 1
Won-N Outer 53103 1060 266 99.51% 8 7 358
Won-ORF1ab Outer 53961 263 205 99.62% 5 2 313
Won-S Outer 52200 179 2050 96.23% 5 1 0
Yip-ORF1ab Outer 53597 210 622 98.86% 5 1 1
Young-N Probe 0 54150 279 99.49% 0 5 1
Young-ORF1ab Probe 54134 179 116 99.79% 5 1 0
Young-S Probe 53562 464 403 99.26% 4 1 0